94
|
Vector Biolabs
aav5 cag flex mcherry Aav5 Cag Flex Mcherry, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5+vectors/pm37018397-319-16-30?v=Vector+Biolabs Average 94 stars, based on 1 article reviews
aav5 cag flex mcherry - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
95
|
Vector Biolabs
construct termed aav5 u6 shfign cmv gfp Construct Termed Aav5 U6 Shfign Cmv Gfp, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5+vectors/pmc06507085-401-6-17?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
construct termed aav5 u6 shfign cmv gfp - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
95
|
Vector Biolabs
control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa Control Virus Aav5 Gfp U6 Scrmb Shrna Caacaagatgaagagcaccaa, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5+vectors/10__1523_slash_jneurosci__0406___21__2021-79-11-17?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
95
|
Vector Biolabs
aav5 cre Aav5 Cre, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5+vectors/pmc04058554-54-3-12?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
aav5 cre - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
95
|
Vector Biolabs
aav5 gfap 0 7 Aav5 Gfap 0 7, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5+vectors/cahill_michelle_kimberly__2023__dissecting_cortical_astrocyte_network_dynamics_using_all_optical_approaches-899-4-5?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
aav5 gfap 0 7 - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
90
|
Vector Biolabs
aav cre gfp virus Aav Cre Gfp Virus, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5+vectors/10__1164_slash_rccm__201910___1958oc-448-22-24?v=Vector+Biolabs Average 90 stars, based on 1 article reviews
aav cre gfp virus - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
95
|
Vector Biolabs
cre recombinase aav5 gfap 0 7 icre t2a mcherry Cre Recombinase Aav5 Gfap 0 7 Icre T2a Mcherry, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5+vectors/bio_rxiv__2025__07__07__663457-269-22-34?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
cre recombinase aav5 gfap 0 7 icre t2a mcherry - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
95
|
Vector Biolabs
virus core gvvc aav 95 aav5 cag Virus Core Gvvc Aav 95 Aav5 Cag, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5+vectors/pm36049479-176-19-38?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
virus core gvvc aav 95 aav5 cag - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
95
|
Vector Biolabs
aav5 Aav5, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5+vectors/pmc10545518-39-10-20?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
aav5 - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
90
|
Applied Genetic Technologies Corporation
aav5 vectors Aav5 Vectors, supplied by Applied Genetic Technologies Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5+vectors/pm29020838-0-87-130?v=Applied+Genetic+Technologies+Corporation Average 90 stars, based on 1 article reviews
aav5 vectors - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
SAB Tech Inc
aav5 aav8 vectors Aav5 Aav8 Vectors, supplied by SAB Tech Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5+vectors/pm39613903-50-0-7?v=SAB+Tech+Inc Average 90 stars, based on 1 article reviews
aav5 aav8 vectors - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |