aav5 vectors Search Results


94
Vector Biolabs aav5 cag flex mcherry
Aav5 Cag Flex Mcherry, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+vectors/pm37018397-319-16-30?v=Vector+Biolabs
Average 94 stars, based on 1 article reviews
aav5 cag flex mcherry - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

95
Vector Biolabs construct termed aav5 u6 shfign cmv gfp
Construct Termed Aav5 U6 Shfign Cmv Gfp, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+vectors/pmc06507085-401-6-17?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
construct termed aav5 u6 shfign cmv gfp - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

95
Vector Biolabs control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa
Control Virus Aav5 Gfp U6 Scrmb Shrna Caacaagatgaagagcaccaa, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+vectors/10__1523_slash_jneurosci__0406___21__2021-79-11-17?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

95
Vector Biolabs aav5 cre
Aav5 Cre, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+vectors/pmc04058554-54-3-12?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
aav5 cre - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

95
Vector Biolabs aav5 gfap 0 7
Aav5 Gfap 0 7, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+vectors/cahill_michelle_kimberly__2023__dissecting_cortical_astrocyte_network_dynamics_using_all_optical_approaches-899-4-5?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
aav5 gfap 0 7 - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

90
Vector Biolabs aav cre gfp virus
Aav Cre Gfp Virus, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+vectors/10__1164_slash_rccm__201910___1958oc-448-22-24?v=Vector+Biolabs
Average 90 stars, based on 1 article reviews
aav cre gfp virus - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

95
Vector Biolabs cre recombinase aav5 gfap 0 7 icre t2a mcherry
Cre Recombinase Aav5 Gfap 0 7 Icre T2a Mcherry, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+vectors/bio_rxiv__2025__07__07__663457-269-22-34?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
cre recombinase aav5 gfap 0 7 icre t2a mcherry - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

95
Vector Biolabs virus core gvvc aav 95 aav5 cag
Virus Core Gvvc Aav 95 Aav5 Cag, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+vectors/pm36049479-176-19-38?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
virus core gvvc aav 95 aav5 cag - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

95
Vector Biolabs aav5
Aav5, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+vectors/pmc10545518-39-10-20?v=Vector+Biolabs
Average 95 stars, based on 1 article reviews
aav5 - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

90
Applied Genetic Technologies Corporation aav5 vectors
Aav5 Vectors, supplied by Applied Genetic Technologies Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+vectors/pm29020838-0-87-130?v=Applied+Genetic+Technologies+Corporation
Average 90 stars, based on 1 article reviews
aav5 vectors - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
SAB Tech Inc aav5 aav8 vectors
Aav5 Aav8 Vectors, supplied by SAB Tech Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+vectors/pm39613903-50-0-7?v=SAB+Tech+Inc
Average 90 stars, based on 1 article reviews
aav5 aav8 vectors - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results